Rapid DNA extraction from ferns for PCR-based analyses.

Pteridophytes are not as well characterized at the molecular and biochemical level as some higher plants. However, to aid conservation efforts (4), there is growing interest in understanding the population biology of many fern species that are under threat. DNAbased studies offer excellent tools for such work, but are hampered in ferns by difficulties in obtaining good-quality DNA from sufficiently large numbers of samples. Extraction of good-quality DNA from plant material is often problematic due to contamination with polysaccharides and polyphenols (1). These classes of compounds inhibit downstream enzymatic reactions such as polymerase chain reaction (PCR) and restriction enzyme digestions. Ferns in general contain large amounts of secondary plant metabolites, perhaps as a defense against predation, as their life cycle includes a vulnerable gametophytic stage. Common fern secondary metabolites include triterpene hydrocarbons, occasionally cyanogenic glycosides (which are extremely toxic) and, in Dryopteris, complex polyketide-derived phenols (7). We are currently studying populations of the maidenhair fern Adiantum capillus-veneris in the UK and Southern Europe using anchored microsatellites [inter-simple sequence repeat (SSR) PCR] (8) and, therefore, require a reliable method for extraction of PCR-quality DNA. A number of rapid DNA extraction procedures for higher plants have appeared in the literature recently (1,6). These include adaptations to improve extraction from recalcitrant higher plants such as some woody species (e.g., fruit trees and conifers) (2). We have tested some of these methods on A. capillus-veneris but found clear evidence of PCR inhibition (E.L. Dempster, unpublished results). We have therefore devised a new protocol based around the cetyltrimethylammonium (CTAB) extraction method of Porebski et al. (5), which includes polyvinylpyrrolidone (PVP), 2-mercaptoethanol and a high-salt precipitation. Our protocol is significantly shorter, removing the need for proteinase K digestion and phenol/chloroform extraction steps, to produce a method that within 3 h results in high-quality DNA that can be used reliably in subsequent PCR amplifications. CTAB (1) and high-salt precipitation (5) are included to prevent precipitation of polysaccharides. PVP reduces the ionization of phenolic compounds, and 2mercaptoethanol prevents their oxidation, thus retaining them in solution (3). Frond material (0.1 g fresh, dried or frozen) is powdered under liquid nitrogen in a mortar and pestle and transferred into a tube containing 500 μL of extraction buffer [100 mM Tris-HCl, 1.4 M NaCl, 20 mM EDTA, 2% (wt/vol) CTAB, 0.4% (vol/vol) 2-mercaptoethanol, 1% PVP (wt/vol) mol wt 360 000, pH 8.0] preheated to 50°C, ensuring dispersal by mixing with a spatula. Following incubation at 50°C for 15 min, 500 μL of Sevag (24:1, chloroform:isoamyl alcohol) are added, and the tube is shaken for 20 min. Following a 15-min centrifugation at 15 000× g in a microcentrifuge, the aqueous layer is transferred to a fresh tube, and the DNA is precipitated with an equal volume of isopropanol and 0.5 vol of 5 M NaCl at -70°C for 1 h. The DNA is recovered by centrifugation at 15 000× g for 10 min, washed with 100% ethanol and resuspended in 100 μL TE. One microliter of 1 mg/mL RNase is added, and following a 30-min incubation at 37°C, the DNA is re-precipitated with 2 vol of freezercold ethanol and 0.1 vol 3 M sodium acetate, pH 5.0. DNA is again recovered by 10-min centrifugation at 15 000× g at 4°C, washed with freezer-cold 70% ethanol, dried for 5 min at 60°C and finally resuspended in 20 μL TE. We have tested the DNA extracted by this method in several applications. Conserved rRNA primers designed in our laboratory (PUV2 = TTCCATGCTAATGTATTCAGAG and PUV4 = ATGGTGGTGACGGGTGAC) have been used to amplify a region of the 18S rRNA from 9 fern species (Figure 1). PCR was performed in an OmniGene Thermal Cycler (Hybaid, Franklin, MA, USA) essentially as described previously (6). Twenty-five-microliter reaction mixtures contained 1 μL of extracted DNA (or a 1:10 dilution of the extracted DNA), 2.0 mM MgCl2, 100 ng of primers, 0.5 mM dNTPs, 1.25 U of AmpliTaq DNA Polymerase (PE Biosystems, Foster City, CA, USA), 10 mM Tris-HCl, pH 8.3 and 50 mM KCl. PCR conditions were the following: 1 cycle of 94°C for 5 min, 50°C for 1 min and 72°C for 1 min followed by 28 cycles of 94°C for 1 min, 50°C for 1 min and 72°C for 1 min and then 1 cycle of 94°C for 1 min, 50°C for 1 min and 72°C for 5 min. Good PCR amplification of the expected 459-bp product was obtained from all 9 species tested, demonstrating the applicability of this DNA extraction method across the Pteridophytes. We have also used DNA extracted from populations of A. capillus-veneris to study variability with the anchored microsatellite primer [HVH(GTC)5] between UK populations within individual sites and between UK and EuroBenchmarks